Jump to content

Mike Tayeb

Members
  • Content Count

    10
  • Joined

  • Last visited

Community Reputation

0 Neutral

About Mike Tayeb

  • Rank
    novice
  1. I created a new folder on the root of our data drive, and left the permissions at the default and it works fine when backups are directed there. There is something about the other folder's permissions that are preventing FM Server from writing there but I sure can't figure out what it is!
  2. If it's using Local System, it shouldn't be a permissions problem then, no?
  3. Permissions of the target: Write permissions for groups R&D and Executives Full Control for Administrators group Administrators group contains Domain Admins and Administrator (user) What account does FileMaker server use when running?
  4. I'm running FM Server 9 on a Windows 2003 SBS SP2 machine. (Yes, I realize that SBS is not a supported operating system, but that's what I'm using and it's not going to be changing any time soon.) I'm currently hosting only two small databases. I have FM server set to back up these databases every hour during the business day. When the time for backup rolls around, I get the following error e-mailed to me from the server. The file does not appear to get backed up, as no backup file appears in the backup folder. Does anyone have any idea what this Error 642 is? I searched here and in
  5. I would like to have a icon on users' desktops for opening a Remotely-hosted filemaker database without having to choose "Open Remote" and go through the process of finding/chosing the host and the filename. Are there any command line switches for the filemaker exe file that will allow me to specify the remote file to open such that the user will be able to bypass the above steps? I can't seem to find any information on this anywhere.
  6. Hi Lee Right after I posted I figured out my problem. The text output from the container field is two values: the filename first, followed by the full path. You have to expand the field in order to see the whole thing. I used the following calculation to grab the path name and report it: =Replace(GetValue(container;2); 1; 9; "") Explanation for others reading this: The GetValue function pulls the full driveletter/path/filename information for the file in the container field called "container". Since the full path information is the second value returned by GetValue,
  7. For me, when I use this function, if I insert a file called "document.doc" into the container, then only the filename "document.doc" is displayed in my External Path field, which is calculated using GetValue(GetAsText(container);1). If I insert only a reference to the file, the output of the GetValue function changes to "file:document.doc". It doesn't actually display the full path. Any idea why? Ideally what I would like is the output to be "Driveletter:Folderdocument.doc".
  8. rcscalebuilder: Could you please post exactly how you got this calculation to work? I tried it as mentioned above (the GetAsText function) but, depending on the type of file in the container, it seems to return different information such as the filename or the file size.
  9. DOH! How did I miss that function in the list?!? Thanks Ender!
  10. I'm new to FileMaker (Pro 8.5 Advanced). I've been trying to figure out how to get FileMaker to count the number of characters entered in a field and then report that number in another field. My situation: We have a database of DNA sequences which are simply long string of letters that represent the base pairs. For example: ACGTGCATCGATGCTGATCGAT I would like to have FileMaker count the number of letters in that sequence and report that number in a separate field. Does anyone have any suggestions on how to go about accomplishing this? Thanks in advance! Mike
×
×
  • Create New...

Important Information

By using this site, you agree to our Terms of Use.