Skip to content
View in the app

A better way to browse. Learn more.
FMForums.com

A full-screen app on your home screen with push notifications, badges and more.

To install this app on iOS and iPadOS
  1. Tap the Share icon in Safari
  2. Scroll the menu and tap Add to Home Screen.
  3. Tap Add in the top-right corner.
To install this app on Android
  1. Tap the 3-dot menu (⋮) in the top-right corner of the browser.
  2. Tap Add to Home screen or Install app.
  3. Confirm by tapping Install.

Calculate number of characters in a field

Mike Tayeb
in Calculation Engine (Define Fields)

Featured Replies

I'm new to FileMaker (Pro 8.5 Advanced). I've been trying to figure out how to get FileMaker to count the number of characters entered in a field and then report that number in another field.

My situation:

We have a database of DNA sequences which are simply long string of letters that represent the base pairs. For example: ACGTGCATCGATGCTGATCGAT

I would like to have FileMaker count the number of letters in that sequence and report that number in a separate field. Does anyone have any suggestions on how to go about accomplishing this?

Thanks in advance!

Mike

Try:

length(field)

  • Author

DOH! How did I miss that function in the list?!?

Thanks Ender!

Create an account or sign in to comment
Go to topic listing

Important Information

By using this site, you agree to our Terms of Use.

I accept

Account

Navigation

Search

Search

Configure browser push notifications
Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.