Jump to content

This topic is 6511 days old. Please don't post here. Open a new topic instead.

Recommended Posts

Posted

I'm new to FileMaker (Pro 8.5 Advanced). I've been trying to figure out how to get FileMaker to count the number of characters entered in a field and then report that number in another field.

My situation:

We have a database of DNA sequences which are simply long string of letters that represent the base pairs. For example: ACGTGCATCGATGCTGATCGAT

I would like to have FileMaker count the number of letters in that sequence and report that number in a separate field. Does anyone have any suggestions on how to go about accomplishing this?

Thanks in advance!

Mike

This topic is 6511 days old. Please don't post here. Open a new topic instead.

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now
×
×
  • Create New...

Important Information

By using this site, you agree to our Terms of Use.