Calculate number of characters in a field

[Mike Tayeb]

I'm new to FileMaker (Pro 8.5 Advanced). I've been trying to figure out how to get FileMaker to count the number of characters entered in a field and then report that number in another field.

My situation:

We have a database of DNA sequences which are simply long string of letters that represent the base pairs. For example: ACGTGCATCGATGCTGATCGAT

I would like to have FileMaker count the number of letters in that sequence and report that number in a separate field. Does anyone have any suggestions on how to go about accomplishing this?

Thanks in advance!

Mike

[Ender]

Try:

length(field)

[Mike Tayeb]

DOH! How did I miss that function in the list?!?

Thanks Ender!