Jump to content
Sign in to follow this  
Mike Tayeb

Calculate number of characters in a field

Recommended Posts

I'm new to FileMaker (Pro 8.5 Advanced). I've been trying to figure out how to get FileMaker to count the number of characters entered in a field and then report that number in another field.

My situation:

We have a database of DNA sequences which are simply long string of letters that represent the base pairs. For example: ACGTGCATCGATGCTGATCGAT

I would like to have FileMaker count the number of letters in that sequence and report that number in a separate field. Does anyone have any suggestions on how to go about accomplishing this?

Thanks in advance!

Mike

Share this post


Link to post
Share on other sites

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.
Note: Your post will require moderator approval before it will be visible.

Guest
Reply to this topic...

×   Pasted as rich text.   Paste as plain text instead

  Only 75 emoji are allowed.

×   Your link has been automatically embedded.   Display as a link instead

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.

Sign in to follow this  

×
×
  • Create New...

Important Information

By using this site, you agree to our Terms of Use.