Skip to content
View in the app

A better way to browse. Learn more.

FMForums.com

A full-screen app on your home screen with push notifications, badges and more.

To install this app on iOS and iPadOS
  1. Tap the Share icon in Safari
  2. Scroll the menu and tap Add to Home Screen.
  3. Tap Add in the top-right corner.
To install this app on Android
  1. Tap the 3-dot menu (⋮) in the top-right corner of the browser.
  2. Tap Add to Home screen or Install app.
  3. Confirm by tapping Install.

Calculation Engine (Define Fields)

Field Types, Field Options, and those wonderful Calculation Functions!

  1. Started by hassam36,

    Does anyone know if the Get(AccountName) function works with multiple users logged on a database? In other words, if there are 5 users logged onto the DB and one clicks a button calling the Get(AccountName) function, does the function retrieve the user name of the person clicking the button or any of the 5 logged onto the DB? Also, do you know if the 'Perform Script' upon open/closing the DB property under 'File Options' works just when the first user opens the DB/file or when any user logs onto the DB regardless of whether there are others already logged on? Paul

    • 2 replies
    • 881 views
  2. Started by hassam36,

    Hello I have a budget layout in FM where I want to the ability to lock certain users out (view, but no updating) of specific budget records when they press a button. We want them to create a budget in this form but when they press a 'submit/commit' button they cannot change the budget values any longer. However, they will still need to access/update other budget records on the same form. I have not thought of a way to do this yet.

    • 4 replies
    • 730 views
  3. Started by mcyrulik,

    We have several databases that have images and PDFs in container fields. What we have found is that if by mistake, you insert a 50 MB PDF into a container, delete it, enter a 50KB PDF, the database still seems to reserve the space for the 50MB PDF. Couple of questions: 1) Is this supposed to happen, or is this a glitch? 2) Is there a way to reclaim that space - optimizing and compacting don't seem to work. The only way that we have found to get that pace back is to export the container field data, remove the field from the DB, compact, optimize and then recreate the field. That seems a bit excessive. Anyone have any ideas?

    • 3 replies
    • 898 views
  4. I'm developing a point of sale system where everything will be scripted...no keyboard, just a touch screen. I have imported the graphics I need for many of the layouts, assigned buttons to each transaction and I am now starting to script. My immediate problem is that I have 3 fields; Register number , Shift number and Cashier number that need input of the appropriate number or possibly 2 numbers for each field. I have designed an on-screen keypad with 0 thru 9 plus an enter key with appropriate buttons for each named 1,2,3 etc. I have these fields as text but they of course could be number if it is better that way. I can't find a way to select the REGISTE…

    • 6 replies
    • 1.9k views
  5. Started by cbm,

    Hello, I'm a newish user of filemaker and could use some help. I'm building a database to track video assets (mainly quicktime) using the pbcore metadata standard. This standard had some metadata fields that are embedded within the quicktime files (mostly tied to the technical attributes of the files - eg. filesize, aspect ratio, frame rate, frame size, etc.). I know that there must be a way to automate this process but am having trouble figuring it out. Ideally, a user would add a file to a container (reference versus the file itself) and a script would run that would fill in these metadata fields. I'm not sure how to proceed. I've figured out how to …

    • 7 replies
    • 2.8k views
  6. Started by Arny,

    I posted this earlier, but can not review any of the comments . . for whatever reason . . so I've just installed 8.5 and am looking for a way to view 'live' video in between 1-3 container fields. Is there any way to accomplish this feat?? Thnx

    • 4 replies
    • 1.5k views
  7. Started by cbadouin,

    All- Does anyone have a solution for calculating a daily finance charge? Thank you CB

    • 3 replies
    • 824 views
  8. I have a table of Subscribers to a newsletter and a table of Subscriptions. I store the date they became a subscriber (JoinDate)but would like a quick and easy way to set their renewal date to be one year plus one month after their joining date. Obviously this has to take into account leap years etc.. Any helpful calculation would be much appreciated. Thank you

  9. Started by patriciag,

    I set up a field to always validate the field's data from a specific value list. Now when I try to reopen the file, the file is stuck on that field, does not recognize any value that is entered, does not allow me to access "define database" to reset the validation of the field, save a copy of the file, or even close the file. The error message is "'FIELD' defined to require a value. Unable to access define database." Any help would be greatly appreciated.

    • 2 replies
    • 876 views
  10. I have a Count field, a CountDate field, and a global CountDate field. When Count is changed, I want to enter the global CountDate into the standard CountDate field. I was using CountDate auto enter = Evaluate("gCountDate"; Count) but then I changed the global field name and things went haywire, until I hunted the issue down. I'd like to have the option of changing field names. So I tried = Let([ C = Count ]; gCountDate) but that triggered whenver gCountDate changed too. Ideas?

    • 6 replies
    • 1.1k views
  11. Hi all I am not sure if something is wrong or FM 8.5 advance works different than FM 6 in the lookup department. In 8.5 advance, I had to use the lookup function to clear the lookup field after the trigger field was accidentally triggered. In FM 6 you could chosen in the lookup format window, the use empty box and when you would clear the trigger field that the lookup would clear it self. I have attached a file to better explain what I want to do. lookup.zip

    • 2 replies
    • 796 views
  12. Started by thelittlestgiant,

    Hello I'm creating a job-tracking log for a construction company. I have a jobs table and a change orders table. Change Orders are viewed via portal and can have a status of "Pending", "Approved", or "Void". In the Jobs table, I would like to summarize the values of each Change Order type. I can summarize the entire portal, but I do not how to break out summaries of "Pending", "Approved", or "Void". Any help is appreciated! Thanks! Joe

  13. Started by Cassetti,

    Hiya! I'm building a basic project manager database for my company (mainly used to keep track of everything when moving into new building) I have 3 tables: Projects Milestones Milestone_Tasks I want to create a field called percentage_complete in the projects table that takes the average percentage of the percent_complete of milestone_tasks and average them among all milestones related to the projects table I hope that makes sense. I'm a bit confused with summary fields and how they work - i haven't played with them very much.

    • 3 replies
    • 1.1k views
  14. Started by decymim,

    Is there any open source quotation solutions for filemaker? Cheers Dec

    • 3 replies
    • 1.2k views
  15. Started by edudna,

    Since I used FM and this is for sure, I noticed that autocalculation does not work as calculation alone when the calculation syntax is complex. This is generate problems if someone want to have a field not only to show results of the calculation but to give the abbility for the client to complete the field with own values. Sometimes you have to click outside the field, sometimes the result dissapear so the field become useless. If someone have to suggest anything I appreciate to put it here so other FM users can see it. Pascal

    • 3 replies
    • 1.4k views
  16. Started by mcdseven,

    First time to this site, first time to ever come into contact with Filemaker. Heres my problem. I have been employed as a Graphic Designer in a large company. Its the first time a role has existed of this kind. On a daily basis I will be processing a large amount of design jobs. As it stands there is no way of recording this (except for an excel sheet). This is what I want to set up. 1. A database that can record all jobs by a roll on number system. So as I process each job it will be assigned a number eg. [color:red]001 Advert 55x35. And it will automatically move on to the next e.g [color:red]002 Poster Internal. 2. A search and find feature so that one year d…

    • 2 replies
    • 1.3k views
  17. Hello, I have a problem with a text field (Customer full name) in a registration table on my file. The problem start wend I create a new record and type a customer name, Filemaker freeze and the sand clock appears. This has never happen before. If I disable the (Auto-complete using previously entered values) the problem disappears. Perhaps my file is corrupted? Field settings: Text Indexed Edit Box Auto-complete using previously entered values Windows FM v8.5 I appreciate any help Thanks.

    • 2 replies
    • 1.5k views
  18. Started by edudna,

    Let we have two tables clients and orders. We need to know from a portal the specific record number with GetNthRecord(orders; x) x=last record number of the client (last order). but how can we know x if in orders table write many clients and not just one? Pascal

    • 4 replies
    • 1.5k views
  19. Started by rapaz,

    Hey everyone, I am back to FMP after a two-year hiatus, and can’t for the life of me get my lookup to fill in the data. I’ve gone through all the books, web pages and done numerous step-by-steps and it just won’t work. I have an inventory database which I am trying to connect to a purchase order, so that when I enter the “product ID” the “description” field fills in. Both were just taken as templates form the business productivity kit (with a few alterations). Its an easy process that I have done many times before…why won’t it work? I have created a relationship, defined the lookup value under the Auto-enter tab. But when I go back to the layout, enter the “pr…

    • 4 replies
    • 1.1k views
  20. I'm not sure if summary fields would be what I use for this or what, but here's the situation. We have an Invoices table and an InvoiceItems related by InvoiceNumber. We also have a Products table and a Scans table related by ItemNumber. Scans is related to InvoiceItems by ScanID. We have multiple conditions of the same product (new open box, factory sealed, damaged, etc). Price could be different depending on condition among other things. We add items to new invoices based on ScanID to ensure that the correct item gets pulled for that invoice. As such, if a customer purchases multiples of the same ItemNumber we have to to add each item onto the invoice on …

    • 6 replies
    • 1k views
  21. Started by John Florance,

    Hi...I'm new to the forum and an "intermediate" level FM person...I apologize if this question is elementary, but... How can I create an "Invoice ID" field that utilizes the first 3 or 4 characters of a company's name and a company-specific serial number?? Eg: if I have 2 companies in my DB (Curly, Larry) and I generate invoices for each of them. I want each company's invoices to have their own sequential serial #'s, even if the invoices themselves are not created sequentially. So, Curly's would always be CUR-001, CUR-002, CUR-003, etc. and Larry's would be LAR-001, LAR-002, LAR-003 regardless of creation order vis-a-vis the other company. Is there so…

    • 1 reply
    • 782 views
  22. Started by DikkeHenk,

    Hi, I need a technique to trigger a single-field that has an auto-enter calculation with any field shown in a portal. The single field auto-enters itself with field-data that's in the related portal. (Aggregate/List function). I am summing the text from the portal in one field. Each time one of the portal fields is changed the single-field has to refresh itself with data from the portal. I know how the trigger an auto-enter single field with another field in the same record but I don't know how to auto-enter a single field triggered from multiple related fields. Is this possible Henk

    • 5 replies
    • 1.2k views
  23. I am looking to sum a field called yards across multiple records automatically for all records not omitted. I have simplified my database and wanted to see if someone can help me with the formula. Sum only shows the field that is selected. I would like to ctrl + F to find a particular showroom, then see how many yards are in that showroom. Thanks. Sum_tool.zip

    • 2 replies
    • 945 views
  24. Started by jbullydawg,

    Good afternoon, This might be pretty straightforward but it is causing me problems. I have a table of student registrations that pulls students in from the Student table. One student can have multiple registrations in one Session and Year in the Registrations table. I need to be able to count only those students with less than 4 registrations. For example: John Doe has three registration records for Summer 1 2007. Jane Doe has five registration records for Summer 1 2007. According to this example, I would need to be able to see that only 1 student is registered for less than 4 classes on a report. Any ideas?

    • 3 replies
    • 923 views
  25. Started by hexxabubba,

    I'm looking for a simple demo that can populate invoice line items once they are paid. For example; there are 4 ine items @ $10 per, and a payment of $50 or $30 comes in; I need it to apply to line items as paid and show balance. I think the running balanvce is easy enough but populating line items is a lady canine.,...Help....

    • 0 replies
    • 804 views
  26. Started by pjp,

    I have a table of companies and a field in that table for the number of patents that the company has received in recent years. I want another field that calculates the rank of this particular company amongst companies in the table according to the number of patents it has received. i.e. the company with the most patents would be ranked 1, that with the second largest number of patents would be ranked 2, etc. I would like the calculation to update when a new company is added to the table and to be available in a variety of layouts and contexts. I figured that I could add a self-join relationship on the number of patents field with an inequality (i.e. to rel…

    • 2 replies
    • 851 views
  27. Started by Curtis_B,

    Maybe it's getting too late for my brain, but I'm stuck on a concept here. I have two related tables, office locations and claims. Each office location will have many claims. Each claim will be linked to only one office (by inputting an office id). For the sake of clarity I will simplify my objective in this post. Lets say I want to have a list in the office locations table, where all offices will be listed row by row. For each row there will be a calculation telling me how many claims that office has in total. I'm not sure how to accomplish this. I know that in SQL I would be selecting the row count where officeid = officeid, for each office. Your …

    • 7 replies
    • 1.3k views
  28. Is there a way to insert a pdf into a container field that can be viewed directly in the field in a cross platform situation? Viewing a file after using Insert Picture only seems to work on Macs. In fact, with Insert Picture, I can't even get pdfs to show up in the dialog box on Windows and have to insert file instead. Insert File doesn't seem to allow the option to view the pdf on either platform. Any thoughts?

    • 2 replies
    • 1.2k views
  29. Started by J. Williams,

    I'm having trouble coming up with a script component that includes the criteria of a certain field being occupied/completed. I.e., if there's anything in this field then... I haven't had any luck getting Not or doesn't = IsEmpty [field] to work. Any shoves in the right direction to be had?

    • 2 replies
    • 1k views
  30. Started by sunkissedeyes,

    i have to update dates in a few related tables. as per my previous post i could not get it to work automatically via a calculation tied to a field. so i'm pursuing a script option. this works, but seems to not be very elegant. Set Field [ AA::DateOut; CC::DateAct ] Set Field [ AA::DateDead; CC::DateDue ] Go to Related Record [ From table: “BB”; Using layout: “LIST” (BB) ] [ Show only related records ] Loop If [ BB::Type = "swap" ] Set Field [ BB::DateEnd; CC::DateDue ] Set Field [ BB::DateBegin; CC::DateAct ] Exit Loop If [ BB::TaskTypeName = "swap" ] Else Go to Record/Request/Page [ Next; Exit after last ] End If End Loop Go to…

  31. Hello all, After building a static database of user present in my servers. I had another thought "Hey, why can't I just talk directly to the server and grab the user list from there?" - This was due to a manual task that I need to do whenever user has been addded in or taken out of the server. Then a manual update of the user account database (fmpro) takes place. (sigh) I am managing quite a number of servers and going in and out of it just to get the total number of users per server is not really an enjoyable thing to do. So if there's anyone out there who knows any trick, be it a script or a plug-in. Please let me know. many thanks! gsunglao

    • 0 replies
    • 793 views
  32. Started by treds,

    Hi I am trying to bring in 3 different fields from 1 file into another file One field is a product code drop down I want to be able to select the product code and have the other fields come into to the layout can bring one in but not 3 any ideas on the best way to bring all 3 fields

    • 5 replies
    • 1.1k views
  33. I'm not sure what I want to do is possible with FM, but here goes: I have a summary report subsorted first by therapist, then by month, in a Notes table that adds up therapist hours based on the billable time they entered for each note. On the month subsummary part, along with the sum of direct service hours, I have a field from a related table, Paid Time Off. The PTO table has a separate record for each therapist for each month, with their PTO time for that month. I have also created in the Notes table a field that totals the therapist's hours for the month like so: Sum(Therapist by Month::Hours Total) + PTO::PTO Hours The Therapist by Month is a self-join…

    • 2 replies
    • 979 views
  34. Started by Anzo,

    1st post here. I have 2 fields- Contract purchase date and a Date of expiration. I just need a simple way to add either 3,5,or 7 years to the Contract purchase date to then reflect the actual Date of expiration in the Date of expiration field . When I use Year with result in text, I get the year correct but no day and month in the Date of expiration field. When I use result in date, the result makes no sense. Yes, I'm pretty new at this, but this is the only thing holding up my little DB. Thanks for any help!

    • 4 replies
    • 1.3k views
  35. Started by Codeus,

    Hi there, I have a table of pupils exclusions, there may be multiple exclusion records for each pupil on different dates. I want to be able to see the total number of days the pupil has been excluded for while adding a new record. To do this, I have created a summary field of days excluded from each record. I then add this summary via a self-join table reference by pupil-name. This works fine, but at present I have to commit the record and refresh the screen to see the changed value (or hit enter while I am in that field). Is there a smarter way to do this that would allow the total field to update automatically? A simplified version of the file…

    • 10 replies
    • 2.6k views
  36. Started by DikkeHenk,

    Hi, I am trying to set a Global variable with a Let statement in a calculation field. The variable is set when I assign it to hardcoded DATA but when I assign it to a field the Global variable stays empty. The calculation-field is supposed not to return anything but I also tried to return with the Gobal Variable ($$_Var) and that does work either. The calculation-field and the referenced field in the 'Let Statement' are in the same table. Need Help Henk Calculation field: Let ( $$_Var = _Field (does not work) ; "" ) or Let ( $$_Var = "blabla" (works) ; "" )

    • 4 replies
    • 872 views
  37. Started by DikkeHenk,

    Hi, Is there a way to delay the auto-enter-calculation of a field or controll the render-order of fields that auto-enter with a calculation. I want to auto-enter a multikey in a field when I create a record. The first value in that multikey is a value that comes from another auto-enter (monokey) in the same record. The fields are created at the same time but maybe it's possible by delaying the multikey-calc for a milisecond. I need this because I auto-create these records from different portals The monokey in the record is (automatecally) auto-entered with the data from the related PortalKey so I can see from wich portal the record is created from. I need the M…

    • 2 replies
    • 846 views
  38. I am trying to create a "case" calculation in (FM7) that will return the invoice total if it is within the defined range. How would I write a formula to show me an invoice total if it is in a range from "$251 to $500"?

    • 2 replies
    • 769 views
  39. Started by Dutchy,

    Hi all, I am trying to make my search/find option a little bit easier to use but it is not really working the way I would like. I have one main layout in which new records can be added and all the info is gathered. The other layouts are reports/table views of the (filtered) data gathered in the main layout. Most of the searching through that data will be done in the table views (as they give me the best overview of the data) After finding the right project/report one can click a button to go to that particular record in the main layout. Now the problem is that I would also like that to work the other way round. To make a button to go back to the previous layout (tabl…

    • 11 replies
    • 2.2k views
  40. Guys, I know this may have been asked so many times. But could someone show me where I could find a sample? Basically, what I needed was; 1) If a selection was made on pulldown menu-A 2) Pull down menu-B would show selection related to pulldown menu-A (Ex: If pulldown menu-A is set to "Asia", then pulldown menu-B should give me selections as "Singapore, Japan, China, Malaysia, etc..." Thanks, gsunglao

    • 3 replies
    • 957 views
  41. Started by fm-bonehead,

    If I have a text field called "field_1" in my filemaker db, and I want "field_2" to contain the text from "field_1" but in ISO-8859-1 format, is there any calculation that will automatically convert the text to ISO-8859-1? Many thanks...

    • 1 reply
    • 821 views
  42. Started by Emma in England,

    The customer (big UK company, NOT amenable to suggestions) supply data in a very unstructured way. Basically, I need to look at a field like this: and extract catalogue numbers, i.e. 513/3831, 513/3161, 513/3178 - note that they don't always put in the '/'! I have been doing this successfully using AppleScript with Satimage's OSAX. But the main user of this system is on a PC (though she'd love a Mac!), and I have read David Kachel's excellent White Paper and can see that if I can do this within FM, I should. Any pointers? Is there an array structure in Filemaker that I could set to {1,2,3,4,5,6,7,8,9,0}? (Sorry if this is a very dumb question, but I…

    • 13 replies
    • 1.8k views
  43. I have a FM 5.5 db that we have used for some program listings on our website using php. We are looking at creating a lobby message board that we would use the same database and would show the events listed for that date. What is not in the db is a list of weekly programs that do not change, they are always on Wed @ 3 pm, Thu @ 10:30 am, etc. I'm trying to incorporate them into my db but am having problems with the date field (we'll call that field webdate). My first thought to get this working is instead of creating a new record for each week's static program I would simply update the date field for each program record. 5 programs, only 5 records needed. I am u…

    • 2 replies
    • 853 views
  44. Started by HunterBoss,

    I know you're not supposed to be able to, but I need to come up with something that looks like it. I'm keeping track of what's in my paper file archives and I need to keep track of what is shredded and when it is shredded. I have a table with box numbers called "box." In this table is a field called "Shredded." I'm using a Value List with yes or no. I have a table of file folders called "contents." In this table I also have a field called "Shredded." I'm also using a Value List with yes or no. When the Box::Shredded is set to Yes, I want Contents::Shredded set to Yes. This I've been able to figure out how to do. My problem is that a file folde…

    • 6 replies
    • 1.4k views
  45. Started by kilikina,

    New to File Maker and I have to create an invoice system, which I've never done. I've been reading up on it but I'm a little confused on how to do it. I have an Invoice table and an Invoice Line table. In the Invoice Line table I have a field for LineID, Item, Quantity, Price, Extended Price, GST and Total...am I on the right track? Now, the items that I want to appear in the invoice vary...some are products that we actually have on hand and others are service fees. Should I create an Inventory table? I will also want to create a Purchase Order table as well and link it to Inventory. Ideally for the invoice, I would like the user to be able to select the item from a …

    • 2 replies
    • 1.1k views
  46. Started by artfairs,

    Hi there, I hope someone out there can help. Let me describe what I want to do and what I've done to try to accomplish this. I've gotten a little stuck on things. Right now, I have a button set up on a "Pre-show Orders" layout, that allows me to send the client an email confirmation after I've inputted all their orders into the appropriate fields. What I would like to happen is that there is a field below this email button that automatically writes the timestamp for when this email was created (and sent). Now, sometimes a client will tweak or alter their order, and this field will need a new timestamp below the older timestamp (for when I send them the updated c…

    • 40 replies
    • 6.6k views
  47. Started by nandito,

    I think this should be a newbie question, but I don't know. I have a container field that I have given a global value. This field has 2 repetitions. I go into a form and I insert images in both containers and everything works nicely. When I exit and restat the file, the containers are empty. I did the same thing on another table a while ago and these fields retained the images. I want to retain the images. Does anyone know what I am missing here? Initially the file was hosted on my computer. Since I have put it in an FM server. Does this have anything to do with it? Thanks, Hernandito

    • 2 replies
    • 1.3k views
  48. Started by Mike J,

    Hope everyone is well. Been working hard on creating some personal DB and came across a need that I can't figure out. Recursive Calculation that generates a code. Two Tables: Order Line Item I have several line items related to an order. I have field in the order table that (Scripting/Recursive Calc) will look at several fields in a line item and generate a CSV for that line item. (Example below of two line items strung together). [color:blue]DLFP,Probe 1,6ACTGTGCATACCCATAGCGT[3BQ1],0.2,HPLC,ShipComplete [color:purple]STND,Probe2,6ACTGTGCATACCCATAGCGT[3BQ1],0.2,DESALT,ShipComplete One thought to generate the code would be to st…

    • 4 replies
    • 1.2k views
  49. Hi All, I work in filemaker 6 and have a problem which i am trying to solve. A field A should be made non-editable ( user can get into the field and copy the contents of the field but cannot modify the field) depending on the value of another field B. These two fields are not in the same layout. I am sure there must be a way to do it but am not able to figure it. Any help is greatly appreciated. Thanks

    • 8 replies
    • 7.6k views
  50. Started by djc728,

    Hello: I'm working on a database that uses a Global Repeating Container field (5 repetitions) to store a graphic with 5 different colors. Questions: (1) How does one input those 5 graphics initially into the container field? (2) Is there a way to print out whats in a repeating container field programmatically? Thanks. Dom

    • 7 replies
    • 2.2k views
  51. Started by cartographer,

    For some reason, this equation only autoupdates, when I select the field in question, or close and reopen the Filemaker document: If(index>1;If(index+skip ≠ index; GetNthRecord ( addtoindex; Get(RecordNumber)-1 )+skip;GetNthRecord ( addtoindex; Get(RecordNumber)-1 )+1);index+skip) where index, skip, and addtoindex are all fields. and this equation gives the results for addtoindex itself. Calculation result is a number. Number of repetitions is 1. Do not evaluate if all reference fields are empty. Storage options is set for Do not store calculation results. And no Global storage is checked. Filemaker 8.0v3, soon upgrading to version 8.5 f…

    • 2 replies
    • 914 views
  52. Started by mf,

    I tried to script adding a file to a container. I would like the script to open in a specific folder (based on a variable) and let the user pick the file. Unless I provide a filename in the variable, it seems that the File Insert command isn't happy... I know that when you have navigated once to the right location, FileMaker remembers where the last insert was done from. But I want to help the user by opening in a standard/calculated location every time. Can it be done? either with File Insert or another command that would set the path before I get to File Insert. Or anyone has a different approach to resolve this?

    • 1 reply
    • 1.1k views
  53. Started by LivingRoutes,

    I'm pretty new to FileMaker, so I'm hoping this isn't a hard question to answer (I just don't know how to do this..) I'm trying to create a report and I want to list all of the people who have not paid for a program which they've registered for. I have a 'People' table which stores their names (among other things), a 'Registration' table which relates a person to a program and tracks if they've paid, and a 'Program' table that has information about the program. I'm not sure if I should use a portal here or what (I don't know how to show a subset of a found set...) so please help! Thanks. -James

    • 5 replies
    • 1.1k views
  54. Have an old FM file that has 880 records in it, we have added a serial number field and asked it to start counting from 881 and this is does with any new records. What we would like it to be able to put the serial number into the old records, of course old records have nothing in the serial field. Apart from typing in 1-880 into every record, could it be done some how I assume changing the field from a serial to something else, add the numbers then turning back on the serial number option. R

    • 2 replies
    • 877 views
  55. Started by selfstorage,

    Please help! I have 3 fields with words that i need to add together into 1 field. I made a calculation with "field 1" & "field 2" & "field 3". This works to combine the words BUT they do not have a space between the words. Can anyone tell me how to put a space between the words so they won't run together.

    • 25 replies
    • 3.5k views
  56. Started by _Kimmie_,

    Hi All, I am creating a DB for a magazine. The DB consists of 12 months per year for 4 years. A company may have purchased certain issues from mid year to mid year on the same contract. I need to generate a unique invoice number per contract (companies can have multiple contracts in one year) and I think if I use the contract date as my trigger I can use a calculation. The problem is I have the dates for each year as one repeating field per year to input contract date. How would I write the calcualtion to look for a group of specific dates, per record in a repeating field to generate a unique invoice number? I am self taught on FM, I have been working with it for a few …

    • 3 replies
    • 1.4k views
  57. Started by abelson,

    Using FM Pro 8.5. I have a file sorted on a specific number field. The number of times each number appears in this field is determined by a Summary calculation (= Count of) followed by a Calculation field (Unstored, = GetSummary). The individual numbers are in the "Body" section of the layout. The count is in the "Sub-summary" of the layout. As such, the count appears after last time the specific number is displayed. This works perfectly. The issue comes when another file performs Relookup of the number being counted and the corresponding count. The counted number is not picked up. Any ideas? I am new at Version 8.5. This works great in Filemaker 2.1 (real old…

    • 3 replies
    • 1.1k views
  58. Hello, I have a field which has a drop down box to select a category, let's say "red", "blue", "green", etc. Each record requires this field to have a selection. I want to count how many times each color was selected. I have hundreds of thousands of records, each with a color or category selected. Currently I do this by using the PatterCount function. It works but it is very, very cumbersome... as I have about 30 different "colors" to choose from so I have to make an individual PatternCount field to summarize each one individually. Secondly, what is the best way to do the "counting" in another table so I don't have some many fields in my primary table? …

    • 11 replies
    • 2.3k views
  59. Started by Raymond Gonzalez,

    Hello! i have a book inventory database. There is a "quantity" field, that is a calculation of the books that i recieved by shipping minus the books i sold. What happen? sometimes i want to add books or remove books randomly, without storing it as sold or as recieved, how can i do that? thanks!

    • 2 replies
    • 865 views
  60. Started by Tom23,

    Hi there, I have created a database that contains personel records. I have a total number of hours worked for a given project and tasks within those projects. I would like to be able to summarise all the hours for a given project or project task but am unsure how to begin.

    • 5 replies
    • 1.1k views
  61. Started by Jalz,

    Hi Guys, I have one file with two tables, Table A and Table B for example. I have a field in table A called mod_tag (text field), which populates with an X If someone makes any modifies a field in Table A. That field also needs to track any modifications done in Table B with value X. This field needs to be stored as a relationship from another file will depend on it. Does anoyone know of a way of storing the value X in a field, if a related field has been modified? I was hoping someone had a nifty technique using the autoenter calculation features..... Thanks Jalz

    • 1 reply
    • 808 views
  62. Hello, I am working on customizing the free version of the Seed Code "CC Gantt Chart". In my "Contracts" section, each job is assigned a STATUS based on a calculation. I would like to use this status to set the color by which the item is displayed on the gantt chart. I have used Case and Choose functions, however, I am confused on how to change this status in the Gantt Chart settings. Can anyone help?

  63. Started by edudna,

    This is a five months developed function. If someone can test it more I will be gratefull. Notice: Employment time is slightly different from regural time. If we say that a teacher worked from 17 to 20 we mean that the employment time is four days: 17,18,19,20. Employ Function Let ([ FBS=Case( Month(Date(2 ; 29 ; Year(dateStart) ) ) = 3 ; 28 ; 29 ); FBE=Case( Month(Date(2 ; 29 ; Year(dateEnd) ) ) = 3 ; 28 ; 29 ); LDS=Case( Month(dateStart)=1; 31; Month(dateStart)=2; FBS; Month(dateStart)=3; 31; Month(dateStart)=4; 30; Month(dateStart)=5; 31; Month(dateStart)=6; 30; Month(dateStart)=7; 31; Month(dateStart)=8; 31; Month(dateSta…

    • 16 replies
    • 2.8k views
  64. Still very new to FM, I have a simple database that stores multi contacts in a TABed area. And it is set so that when you enter the first contact it also auto fills in the second contact with the same data, so if the user is in the wrong TAB they see the same address, then if they want the second contact different they simple type over the data. This I have got to work with no problem, auto fill second contact with first contact data, thats simple. The problem I have is the postal code area I have set to be upper case with a calculation " upper (contact 1 postcode) " and this works on the first contact. But how do I do this with the second contact. …

    • 8 replies
    • 1.3k views
  65. Started by durian,

    With scripts I can monitor the the script using Debug Scripts (or in the old days - dialog boxes). But is there any way to follow the execution of a calculation - or, to be more precise, a Custom Function? I've got a calculation I just don't think is executing (it's an Auto-enter calc) but am not sure how to see what's happening. With PHP I'd just 'print' or 'echo', but in Filemaker I don't see a calculation step that'll help me in any real way. Any ideas or solutions? Thanks, Nelson

    • 5 replies
    • 1.1k views
  66. Started by Jana,

    Hello, I'm struggling with trying to extract the last word in a field, so that I can then extract the first initial of that last word. Someone else set up a name field that contains a persons full name rather than separate FirstName, MiddleName, LastName fields. (Some entries have 2 words some have 3). Example: Mary Eileen Jones Jane Smithson In the end I want to get the initials of the person's first and last names. Thus, MJ or JS from the above example. I had hoped Last function would work but it doesn't. It gave me all three words in Mary Eileen Jones. I've managed to extract all kinds of thing with different, but not the last word's fir…

    • 6 replies
    • 1.3k views
  67. Started by sirtemplar,

    hi again. may someone help me translate the following calculation o have from excel. =MEDIAN(D2:D51,G2:G51) i am trying to get the median. i get it in excel but not in filemaker. d2:51 are the values on the D field and g2:g51 on another. thanks

    • 4 replies
    • 5.2k views
  68. I have a reporting tool wiht two (main) tables. One is an attendance summary (Attendance_Utility) with one record per student. The other is a collection of the attendance data (Attendance_Calc) with one record per day per student and typically contains 30000 to 70000 records (number of days * number of students). The tables are related by a students ID (unique in the summary table, many instances in the data table). For each record in the data table there is a daily status indicator. If it changes from the enrolled state to the withdrawn state a flag is set. If the flag is set I should be able to pull the "Status_Change_Code" for that record from the data table to t…

    • 1 reply
    • 816 views
  69. I have two date fields, sign in and sign out. I'd like to be able to automatically clear the sign in field when the user inserts a date in the sign out field and clear the sign out date when the user inserts a sign in date. Please help.

    • 8 replies
    • 1.5k views
  70. I know I'm doing SOMETHING wrong, but I can't figure it out. The ultimate goal here is to mark an item Sold or Returned automatically based on it being sold or returned, obviously. We have a tabled called Scans that stores all of our item's data with a unique ScanID. The Scans table is related to InvoiceItems on ScanID. This is a 1 to many relationship because a ScanID could end up with multiple InvoiceItems records. I've created a calc. field in InvoiceItems called zInvoiceTypeCalc. The calc. for this field is as follows: Case ( Invoices::Record Type = "Invoice" ; 1 ; Invoices::Record Type = "Credit Memo" ; -1 ) So if the invoice record w…

    • 15 replies
    • 1.6k views
  71. Started by lardawge,

    I need to find out if it is possible to store files (pictures) as references in a central location that every user can see. As well as a way to have individual clients be able to insert those pictures and have them copy to that central location and the location used to serve them up on the web using xslt. Let me know if this is clear. I am familiar with the import command and am using it to insert the pictures into the container at this point... need to know if it is just a simple file path adjustment. If so what is the filepath used for a network volume?

    • 5 replies
    • 1.9k views
  72. Started by bens,

    I'm working on a database that register the work time. I have set a start time and a finish time for each case. What i want is to count the ours of different cases, and the total of each day minus lunch time. If put in a new start time the count says 9 ours, how can i get a count time only if there is a finish time. If anyone has a better idea how to make the database please let me know. I have attached the file. register.fp7.zip

    • 9 replies
    • 1.3k views
  73. Started by artfairs,

    Hi there, I'm a little stuck on this, I'm hoping someone can help. Right now I have a "Created", "Modified" and "Modified by" field on each layout of my database. Each field has a timestamp, except for the modified by, which states the user's name. What I would like is that each time a layout is modified (data is inputted or altered in a field), the timestamp for "modified" will update to the current date, and ONLY for that particular layout, not the entire record. How can I go about doing this? Right now these fields update automatically on each layout instead of updating separately. Please let me know if I'm not being clear.

    • 11 replies
    • 2.3k views
  74. Started by SharkFin85,

    If I put the sum(Field01) function in a calculation field the result is.... Field01 of 1st Record + Field01 of 2nd Record + Field01 of N Record. My problem is that i don't want to sum all the records,

    • 4 replies
    • 1.3k views
  75. Hello, I have FM 6.0 and I would like to all values in one column to summed up automatically and to be displayed in one speperate field. Is there a way? Thanks Ralf from Uganda

    • 1 reply
    • 1.2k views
  76. Is there a way to customize buttons so that lets say a button represents a cage of mice and there are 3 mice in the cage, for the number 3 to appear on the button to display that there are 3 mice in the cage and also if there is a way to customize buttons so that if a new button is added, to differentiate between types of cages (breeder/stock) based on color. This might sound confusing so if there is anyone who is knowledgable in FMP 6, could you please email me for some help and so that I could clarify my problem more clearly. Thanks for your time. -David Lee email: [email protected]

    • 1 reply
    • 889 views
  77. Started by Raymond Gonzalez,

    Hello! i have a "sex" field with a "m/f" radio button. Is there a way that when i click on "m" the color of the tab where it is will change to blue and when i click on "f" it will change to pink? Thanks!

    • 5 replies
    • 1.8k views
  78. Hi, I have two date fields, "startdate" & "enddate" and a field called "actiondate" I am having issues working out how I can set a calculation script on the actiondate to automatically populate. I would like the actiondate to look at the fields "startdate" & "enddate" and if a date range exists between these fields place the "startdate" into "actiondate" Please can someone lend a hand! Cheers, Dan ???

    • 3 replies
    • 1.1k views
  79. Hi, I want to make a button that will open a second window, add a new record, but place the current record (from first window)'s ID in a field. It tried to script it using the SET FIELD,... with field::fieldID, but it doesn't work, can anyone help me out? Basically I am trying to avoid turning the create records in portal situation. lj

    • 4 replies
    • 1.2k views
  80. I was wondering how to create a button that removes an entry from the database and automatically archives it in a separate file linked to the database. The only function that I could find was removing an entry entirely, but I was wondering if there was any way to move the file to another database rather than delete it.

    • 2 replies
    • 1.2k views
  81. Hello, I wish to know how you can open a pdf file stored in a container field by double-clicking on it, from another filemaker file. I have a filemaker file "patients.fp7" and a filemaker file "files.fp7". In "files.fp7" I store pdfs in container fields. Each one is stored and related to a "patient_id" number from the "patients.fp7" file. In my "patients.fp7" file I can display the related container field. I can actually see the pdf file in the container, but when I double-click on it nothing happens. However, I can right-click on it and export the content anywhere I want. I wish to make a script that will display the file for instance in preview (mac o…

    • 1 reply
    • 1.3k views
  82. Started by Joost Miltenburg,

    Hi, This probably is easy, but how do you substitute a quote ? I have tried substiute( field ; """ ; "something else" ) , but that doesn't work. The " stays in there, same goes for ' apostrophe. Any takers ?

  83. Started by DNA,

    Hi there I have a field with this date format in it: 4/16/07 - 4/22/07 That I want to extract the week number from for the second date set I am familiar with the week(field) format but that's based on a particular date. This field is just a number field at the moment and as you can guess the field length changes as the dates do eg. 1/3/07 - 12/19/07 so the standard left(field) command won't work either. Anyone come across this before or have a solution? Regards Mark

    • 4 replies
    • 1.3k views
  84. Started by Leather Knight,

    I have 2 fields that are times(start time and end time) I also have a total time field. The first 2 are set as "11:00 PM" and I want the total time field to show the total time without the "am/pm". How do I make it do that?

    • 6 replies
    • 1.4k views
  85. Started by rick fry,

    I am trying to create an output field which writes to an xml file. I need to put line feeds at the end of each line in the calculation. If I put the return symbol between quotes the field output looks fine in filemaker but when i open the file in another application (xmlspy) i get the following "directions2.wavThis is the text for message 2"

    • 0 replies
    • 982 views
  86. Started by CAS,

    I have a specific question regarding related tables and auto-calculations or summaries. I still feel I am relatively new to alternative options to figure things out in filemaker, so hoping there is an easy or easier answer to this. In table A I have 200,000 records that have a field that defines its locality by a 10 digit number, we'll call it "LOCALE" that can be one of 395 unique locations and a descriptor field that can be 1 of 350 unique options that is in a field called "ID" . In the related table "B" I have 395 rows of data that are the 395 LOCALES and the fields are the 350 IDs. If this were much smaller database exporting the whole bunch into Excel a…

    • 2 replies
    • 1k views
  87. I am using FM. v8. Is there a formula to find any excact matching values in a [field A] with a value in another [field B]? Both fields are repeating fields. The 1st having [field A]25 rep's, and the 2nd having [field B]7 rep's. I use a valuelist to display in [field B] all the values of [field A], but once a MATCHING VALUE is used in [field B], then that particular value to NOT be displayed in the valuelist anymore. I need a formula to find any EXACTLY MATCHING values in any of the values in [field A] that are found in [field B]. I can create a 3rd field [field C] and here i would like displayed any values that are NOT matched in [field B]. …

    • 22 replies
    • 5.2k views
  88. Started by ddiener,

    I am trying to print a FM report that lists one field from five separate records in a single horizontal line similar to the "mailing label" layout. The next line(row) would contain data from the next five records and so on. The kicker (and why I can't use the mailing label template) is that I need to include some text at the beginning of each row. The row would resemble - Text, record 1 field A, record 2 field A, record 3 field A, record 4 field A, record 5 field A. The next row would repeat the pattern but with different text and the next five records. I have tried everything I can think of including using GetNthrecord, exporting to excel and word but nothing prov…

    • 5 replies
    • 1.4k views
  89. Started by mikemccloskey,

    I have a situation in which I would like to add multipage PDFs into a filemaker record, then be able to view all pages. Does anyone know of a way to do this? I am using FMP 6 but could use 7 or 8. Thanks, Mike

    • 3 replies
    • 1.3k views
  90. Started by ljm,

    I am trying to get a count of all the unique names in a list - I can get a count of all the names in the list, but am stumped on how to get the count to be just the unique values. For instance Linda Linda Linda James would return 2 Thanks, Linda

    • 4 replies
    • 1.2k views
  91. Started by SharkFin85,

    If for example i a field and i don't want it to appear in a layer but i want to use the "Insert Calculated Result" Script to put some data into this field, the field doesn't accept this data from the script.... Do someone know why?? Sorry for my English...

    • 6 replies
    • 1.7k views
  92. Started by lonesomejubilee,

    Hi, I have two fields, a count field that just tells me how many are not blank and an overall summary of that field... but what if I want a dynamic field that re-calulates the first field on a weekly basis? i can't figure out how to get there. I want to track info based on weeks, not an overall picture basically. Thanks... and my son's basketball team thanks you!

  93. Started by rudon,

    I have a single table but many different layouts. If data is imported into the table using layout A, the value of Field 1 needs to be calculated differently from when layout B is being used, and so on. The layouts handle different input formats for data that need to be added to the table from different source files. The system works well when I use complicated Case, If, Choose clauses handling the whole series of layouts (about 12) in the autoenter calcalution for Field 1. Since this is repeated for many different fields the database however becomes difficult to maintain when there are changes in the formats of the sourcefiles. An alternative would be to set a table up …

  94. Started by Dr.Hamed,

    I have an auto-enter serial number field that I need to reset every new month (starting with yy-mm001) how would I do that? I managed successfully the calcualtion as: [color:red]Right(Year(DATE);2) & "-" & Right("0"&Month(DATE);2) & Right(("00"&serial);3) where the DATE field is record creation date and the serial field is auto-enter field incremented by 1. I just need to reset the serial field "the last three digits" every month. Best Regards

    • 28 replies
    • 4.9k views
  95. Hi is there a way to create a field that will take the data from related records, and put it in the field with commas separating the info from each related record? Here is the situation: I am building a database that uses portals to keep track of things like product categories offered by companies in each record, and another portal with notes or comments that we gather over time. I need to be able to export all of this to a flat file fairly often, and when I do, I just want one field with all the products/services offered by a company in one field (separated by commas) and all the comments that have been gathered over time in another field (preferably with date…

    • 8 replies
    • 1.4k views
  96. Started by Stephen K,

    This is a FMP6 problem. I have a calculation field that returns a grade A to E based on other fields. I need to be able to allow a user to over-ride the calculated grade if they wish. Is this possible with a calculation field...or can anyone suggest how I can do this. Cheers Stephen

    • 2 replies
    • 956 views
  97. Hello I am wondering if there is a way to script toggling from list view to table view and form view. I would like to make a button to do that without leaving the present layout. I just don't see how to do it. Thanks Dave

  98. Started by jrRaid,

    I need to parse numbers in separate fields. Base is a text field with data: 124.23F or 12.34G or 123.4H or 1.23K. There will be always one letter, no problem to parse that part. For the number left of the period I use: Left ( myField; Position ( myField; "."; 1; 1) - 1) Works well. If I follow the same logic (well, my logic), for the part right of the period I could use: GetAsNumber ( Right ( myField; Position ( myField; "."; 1; 1) - 1)) GetAsNumber because the result of the parsing has to be number and I don't want the possible letters. I just got 1 number as result. When I change the -1 to +1, the result takes sometimes 1 chara…

    • 9 replies
    • 1.1k views
  99. Started by cferri2005,

    I am working on an employee PTO and time off schedule, and I am having a bit trouble working out a calculation formula for the PTO/month value based on the amount of years that they have been employed. For instance; If an employee has worked here 4 years or less they earn 1.83 days off per month. 5 - 9 years, and they earn 2.25..and if they work 10 or more years, they earn 2.67 I'll give a quick run down of what I want and see if anyone knows where I should start. **** If the value of a field is less than or equal to 4, then enter a value of 1.83 If the the value of a field is greater than 4 but less than 10, then enter a value of 2.25 If t…

    • 2 replies
    • 848 views
  100. I'm new to FileMaker (Pro 8.5 Advanced). I've been trying to figure out how to get FileMaker to count the number of characters entered in a field and then report that number in another field. My situation: We have a database of DNA sequences which are simply long string of letters that represent the base pairs. For example: ACGTGCATCGATGCTGATCGAT I would like to have FileMaker count the number of letters in that sequence and report that number in a separate field. Does anyone have any suggestions on how to go about accomplishing this? Thanks in advance! Mike

    • 2 replies
    • 1.8k views

Recently Browsing 0

  • No registered users viewing this page.

Who's Online (See full list)

  • There are no registered users currently online

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.